It is awe-inspiring to be alive at this moment when humanity has made such a great discovery. When we have unlocked one of the big secrets of the universe. When the world as one has laid aside its differences to celebrate a momentous revelation.
I refer of course to the release of the latest Harry Potter book.
Human genome jump back! Here's an alphabet sequence we can really understand.
And that understands us.
Why has Harry Potter generated more excitement than the human genome? Allow me to demonstrate.
Here is a section chosen at random from the human genome:
"taggtactgactgcatagttttcctatatatatacgagacatgcctcttgattacat."
Here is a paragraph chosen at random from "Harry Potter and the Goblet of Fire:"
"Harry lay flat on his back, breathing hard as though he had been running. He had awoken from a vivid dream with his hands pressed over his face. The old scar on his forehead, which was shaped like a lightning bolt, was burning beneath his fingers as though someone had just pressed a white-hot wire to his skin."
You get the picture.
I have spent the last few weeks earnestly trying to understand the human genome. I read the articles in the local and national newspapers. I studied Barry Smith's column on haploids and diploids in the newsroom. And I still don't get it. Something is lost in the translation.
I dare say what the human genome needs is a J.K. Rowling to help tell its tale.
My kids clearly prefer Potter to genome. When my husband brought up the human genome at dinner the other night, the conversation was brief.
Husband: "Have you guys heard about the success of the human genome project? It's really a great achievement. Scientists have read all three billion letters in human genes. So now they have read the entire book of instructions that make all the cells in our bodies, from our bones to our skin."
Daughter #1: "That's cool. So what does the genome say when they read it? Does it say 'make bones' and 'make skin'?"
Husband: "Well, not exactly. It is a chemical language. The four letters of DNA combine in three-letter words that are instructions for making amino acids, which are combined into proteins, which are chemicals that cells use to make bones and skin and everything."
Daughter #1, jumping up and down in frustration: "But if it's a language and they can read it, then what does it say?"
Daughter #2, looking as though she may fall asleep: "Can we go listen to Harry Potter now?"
It's true, we are Harry Potter addicts. We met him last summer. I read the first three books aloud to the kids. My older daughter reread them to herself. Last Saturday morning we were at Kennedy's Books to nab one of the first copies of "Harry Potter and the Goblet of Fire" in Carson City.
The Harry Potter books offer kids a magical view of the world we Muggles (non-wizards) can't see. Harry and his friends are kids like yours and mine, more or less. But in the midst of fretting about homework they are challenged by encounters between good and evil and the high-jinx of life at wizard boarding school. Harry's world is one of comical spells, living schoolbooks, and quidditch, a game played on flying brooms.
I'm sure many kids would love to live in Potter's world, at least for a spell. This summer, they can share the magic because J.K. Rowling is one of the great writers of the magical genre.
The genome's magic, on the other hand, is still buried in scientific language. Every now and then one gets a whiff of its mysteries. To think that this language is shared by all living things. And that the genes that guide the unfolding of an embryo are the same for worm and human alike. And that subtle changes in this magical spell can create the astonishing diversity of life on earth.
If it were in a Harry Potter book, the human genome might come alive as a vibrant and powerful being bearing life in one hand, death in the other. Its infinite heart might contain the whole world of critters and people. It might shoot rays of light from its twirling, entwined body. It might be terrible to imagine but wise beyond understanding.
Someday someone will write a great kid's book featuring the human genome and a scientific heroine. But for now at least we have another great Harry Potter book to keep kids reading and dreaming.
Well, I gotta go. Someone's tugging on my arm. Time to read.